ORK07591

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07591

Order Kazusa clone(s) from :

Accession No	AB208848
Product ID	ORK07591
Clone name	fj02593
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RASGRP1
cDNA sequence	DNA sequence (4041 bp) Predicted protein sequence (530 aa)
Description	RAS guanyl releasing protein 1

Features of the cloned cDNA sequence

Description

Length: 4041 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2448 bp
Genome contig ID	gi51511731r_36467600
PolyA signal sequence (GATAAA,-22)	+--------+--------+----*----+---- GTAATATTTATATGATAAAAGACATTAGGATCCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAACACAAATGTCTTGTGTTTCTTCTGCTTCGTGACCCCGTAAACACTT

Features of the protein sequence

Description

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92085	1e-216	100.0	Ras activator R...	Homo sapiens
AAX54699	1.3e-216	100.0	Ras guanyl rele...	Homo sapiens
XP_612430	2.7e-205	94.7	similar to Ras ...	Bos taurus
AAW32406	1.5e-144	100.0	RAS guanyl rele...	Homo sapiens
XP_001253122	1.5e-140	97.1	similar to Ras ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	272	286	PR00008	Protein kinase C
	IPR002219	288	297	PR00008	Protein kinase C
	IPR002219	301	312	PR00008	Protein kinase C
	IPR002219	313	325	PR00008	Protein kinase C
HMMPfam	IPR001895	2	153	PF00617	Guanine-nucleotide dissociation stimulator CDC25
	IPR002048	207	235	PF00036	Calcium-binding EF-hand
	IPR002048	239	262	PF00036	Calcium-binding EF-hand
	IPR002219	275	327	PF00130	Protein kinase C
HMMSmart	IPR001895	1	205	SM00147	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR002219	275	324	SM00109	Protein kinase C
ProfileScan	IPR001895	1	204	PS50009	Guanine-nucleotide dissociation stimulator CDC25
	IPR002048	203	238	PS50222	Calcium-binding EF-hand
	IPR002048	239	265	PS50222	Calcium-binding EF-hand
	IPR002219	274	324	PS50081	Protein kinase C
ScanRegExp	IPR002048	216	228	PS00018	Calcium-binding EF-hand
	IPR002048	243	255	PS00018	Calcium-binding EF-hand
	IPR002219	275	324	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp