ORK06452

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06452

Order Kazusa clone(s) from :

Accession No	AB209197
Product ID	ORK06452
Clone name	fj03824
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPM1G
cDNA sequence	DNA sequence (3752 bp) Predicted protein sequence (347 aa)
Description	Protein phosphatase 1G (EC 3.1.3.16) (Protein phosphatase 2C isoform gamma) (PP2C-gamma) (Protein phosphatase magnesium-dependent 1 gamma) (Protein phosphatase 1C).

Features of the cloned cDNA sequence

Description

Length: 3752 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	404 bp
Genome contig ID	gi89161199r_27357566
PolyA signal sequence (ACTAAA,-23)	+--------+--------+----*----+---- ACACTTTTTCAGACTAAAGGCCAAAACCTAATCGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGCATCGTGTCCTTTTTTTTCTGCTGCCGTGGCCCCCGACTTGGTCCCA

Features of the protein sequence

Description

Length: 347 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92434	1.1e-116	100.0	protein phospha...	Homo sapiens
XP_001156760	2.3e-114	100.0	similar to prot...	Pan troglodytes
XP_001156303	7e-110	100.0	similar to prot...	Pan troglodytes
AAH07361	3.1e-101	95.0	PPM1G protein [...	Homo sapiens
XP_525722	4.4e-101	83.1	protein phospha...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	35	293	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	41	304	SM00332	Protein phosphatase 2C-related

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp