ORK06824

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06824

Order Kazusa clone(s) from :

Accession No	AB208849
Product ID	ORK06824
Clone name	fj07082
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SHC1
cDNA sequence	DNA sequence (4205 bp) Predicted protein sequence (377 aa)
Description	SHC-transforming protein 1 (SH2 domain protein C1) (Src homology 2 domain-containing-transforming protein C1).

Features of the cloned cDNA sequence

Description

Length: 4205 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3070 bp
Genome contig ID	gi89161185r_153101399
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AGGGAAAACTCTTCATTAAAGTCCGTATTTCTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTCTGCCTCTTAACCCTTCTGGGAAGCCTATTGTGTACGCCGCGGGCC

Features of the protein sequence

Description

Length: 377 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92086	1.8e-133	100.0	SHC (Src homolo...	Homo sapiens
EAW53167	2.2e-133	100.0	SHC (Src homolo...	Homo sapiens
AAH33925	6e-113	100.0	SHC1 protein [H...	Homo sapiens
CAI13254	6.2e-113	100.0	SHC (Src homolo...	Homo sapiens
CAA48251	7.3e-113	100.0	SHC transformin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	267	321	PD000093	SH2 motif
FPrintScan	IPR006019	7	16	PR00629	Phosphotyrosine interaction (PID or PI)
	IPR006019	30	58	PR00629	Phosphotyrosine interaction (PID or PI)
	IPR006019	65	91	PR00629	Phosphotyrosine interaction (PID or PI)
	IPR000980	267	281	PR00401	SH2 motif
	IPR000980	284	294	PR00401	SH2 motif
	IPR000980	296	307	PR00401	SH2 motif
HMMPfam	IPR006020	1	97	PF00640	Phosphotyrosine interaction region
HMMPfam	IPR000980	267	344	PF00017	SH2 motif
HMMSmart	IPR006020	1	100	SM00462	Phosphotyrosine interaction region
HMMSmart	IPR000980	265	358	SM00252	SH2 motif
ProfileScan	IPR006020	7	118	PS01179	Phosphotyrosine interaction region
ProfileScan	IPR000980	267	342	PS50001	SH2 motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	324	AEVWVRGGKKEGTVPYSVSLFLP	346	SECONDARY	23
SOSUI2	2	355	WAAVYGPLLLFKVSGIFLQRLIP	377	PRIMARY	23