ORK07593

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07593

Order Kazusa clone(s) from :

Accession No	AB209210
Product ID	ORK07593
Clone name	fj08803
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DVL1
cDNA sequence	DNA sequence (4402 bp) Predicted protein sequence (387 aa)
Description	Homo sapiens mRNA for dishevelled 1 isoform a variant protein.

Features of the cloned cDNA sequence

Description

Length: 4402 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2448 bp
Genome contig ID	gi89161185r_1160527
PolyA signal sequence (ACTAAA,-20)	+--------+--------+----*----+---- CTGCTTATTTTAAACACTAAAAAGCGTTTAATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGGACAGATGTGTGGCCTGTGCCCCTTCTCTCCGGCTGGGCTGCCTTG

Features of the protein sequence

Description

Length: 387 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92447	8.3e-106	100.0	dishevelled 1 i...	Homo sapiens
EAW56225	1.5e-55	90.8	dishevelled, ds...	Homo sapiens
BAC04089	1.6e-55	90.8	unnamed protein...	Homo sapiens
O14640	2.2e-55	90.8	Segment polarit...	Homo sapiens
AAV67401	1.6e-54	89.6	dishevelled 1 [...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008339	95	107	PR01760	Dishevelled region
	IPR008340	138	149	PR01761	Dishevelled-1 protein
	IPR008339	191	201	PR01760	Dishevelled region
	IPR008339	217	228	PR01760	Dishevelled region
	IPR008340	236	248	PR01761	Dishevelled-1 protein
	NULL	253	265	PR01217	NULL
	IPR008340	282	298	PR01761	Dishevelled-1 protein
	NULL	312	324	PR01217	NULL
	NULL	325	346	PR01217	NULL
	NULL	346	362	PR01217	NULL
HMMPfam	IPR000591	160	232	PF00610	Pleckstrin/ G-protein
HMMSmart	IPR000591	160	234	SM00049	Pleckstrin/ G-protein
ProfileScan	IPR000591	160	234	PS50186	Pleckstrin/ G-protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp