ORK10417

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10417

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10417
Clone name	fj09834
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPS8
cDNA sequence	DNA sequence (3845 bp) Predicted protein sequence (896 aa)
Description	Epidermal growth factor receptor kinase substrate 8

Features of the cloned cDNA sequence

Description

Length: 3845 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1154 bp
Genome contig ID	gi89161190r_15564365
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GGAAAGTCTGCAATAAACAGTATTTGCTGTCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAAATGGTTTCTGTCTCATTAGCAAAAAGGATCTGTGCTAGATCGGCT

Features of the protein sequence

Description

Length: 896 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001091077	96.5	epidermal growt...	Macaca mulatta
XP_528750	99.5	epidermal growt...	Pan troglodytes
Q12929	100.0	Epidermal growt...	Homo sapiens
AAX36698	100.0	epidermal growt...	synthetic construct
AAH30010	99.8	Epidermal growt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	608	657	PD000066	Src homology-3
FPrintScan	IPR001452	608	618	PR00452	Src homology-3
	IPR001452	622	637	PR00452	Src homology-3
	IPR001452	650	662	PR00452	Src homology-3
HMMPfam	IPR013625	138	268	PF08416	Tensin phosphotyrosine-binding domain
HMMPfam	IPR001452	608	662	PF00018	Src homology-3
HMMSmart	IPR006020	134	271	SM00462	Phosphotyrosine interaction region
HMMSmart	IPR001452	608	663	SM00326	Src homology-3
ProfileScan	IPR001452	605	664	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp