ORK05801

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05801

Order Kazusa clone(s) from :

Accession No	AB208853
Product ID	ORK05801
Clone name	fj09987
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LAMA3
cDNA sequence	DNA sequence (4573 bp) Predicted protein sequence (1408 aa)
Description	Laminin subunit alpha-3 precursor (Epiligrin 170 kDa subunit) (E170) (Nicein subunit alpha).

Features of the cloned cDNA sequence

Description

Length: 4573 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	345 bp
Genome contig ID	gi51511735f_19632966
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTGTTAAAAAAATTAAATATATTTTAAAGCACTTT
Flanking genome sequence (155991 - 156040)	----+--------+--------+--------+--------+----* AAGAATATGAAACTTTCATATATGTTAAAGGATTATAATTTATGGAATTA

Features of the protein sequence

Description

Length: 1408 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92090	100.0	Laminin alpha 3...	Homo sapiens
Q16787	100.0	Laminin subunit...	Homo sapiens
EAX01167	100.0	hCG1811249, iso...	Homo sapiens
EAX01166	100.0	hCG1811249, iso...	Homo sapiens
CAA59325	100.0	alpha 3B chain ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009254	1	180	PF06008	Laminin I
	IPR010307	363	491	PF06009	Laminin II
	IPR012680	701	821	PF02210	Laminin G
	IPR012680	872	979	PF02210	Laminin G
	IPR012680	1091	1211	PF02210	Laminin G
	IPR012680	1261	1386	PF02210	Laminin G
HMMSmart	IPR001791	489	645	SM00282	Laminin G
	IPR001791	693	821	SM00282	Laminin G
	IPR001791	864	979	SM00282	Laminin G
	IPR001791	1083	1211	SM00282	Laminin G
	IPR001791	1253	1386	SM00282	Laminin G
ProfileScan	IPR001791	465	666	PS50025	Laminin G
	IPR001791	673	835	PS50025	Laminin G
	IPR001791	842	1002	PS50025	Laminin G
	IPR001791	1061	1225	PS50025	Laminin G
	IPR001791	1232	1405	PS50025	Laminin G
ScanRegExp	IPR001844	1348	1359	PS00296	Chaperonin Cpn60

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp