ORK05257

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05257

Order Kazusa clone(s) from :

Accession No	AB208854
Product ID	ORK05257
Clone name	fj11313
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GAK
cDNA sequence	DNA sequence (3987 bp) Predicted protein sequence (1196 aa)
Description	Cyclin G-associated kinase (EC 2.7.11.1).

Features of the cloned cDNA sequence

Description

Length: 3987 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	395 bp
Genome contig ID	gi89161207r_733066
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TGGTTGTCTGTACAGAATTAAACTATTTTCCGATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCTGTGTCTCCAGTGTGGATCCACTCGCCCAGGTGCCGTTCACCAGC

Features of the protein sequence

Description

Length: 1196 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92091	100.0	Cyclin G-associ...	Homo sapiens
XP_001140764	99.5	cyclin G associ...	Pan troglodytes
XP_001094120	97.1	similar to cycl...	Macaca mulatta
XP_001917873	82.3	cyclin G associ...	Equus caballus
EDL20099	80.5	cyclin G associ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1	214	PD000001	Protein kinase
HMMPfam	IPR000719	14	209	PF00069	Protein kinase
HMMPfam	IPR001623	1146	1185	PF00226	Heat shock protein DnaJ
HMMSmart	IPR002290	3	213	SM00220	Serine/threonine protein kinase
	IPR001245	5	209	SM00219	Tyrosine protein kinase
	IPR001623	1131	1192	SM00271	Heat shock protein DnaJ
ProfileScan	IPR000719	1	210	PS50011	Protein kinase
	IPR014019	295	462	PS51181	Phosphatase tensin type
	IPR014020	468	606	PS51182	C2 tensin-type
	IPR001623	1132	1196	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR008271	65	77	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp