ORK07600

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07600

Order Kazusa clone(s) from :

Accession No	AB290165
Product ID	ORK07600
Clone name	fj14406y3
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNAH6
cDNA sequence	DNA sequence (6925 bp) Predicted protein sequence (2250 aa)
Description	Homo sapiens mRNA for DNAH6/KIAA1697 variant protein

Features of the cloned cDNA sequence

Description

Length: 6925 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	172 bp
Genome contig ID	gi89161199f_84638927
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTATGACCTTAAAATAAAGTGTTTGAGTTCTTTC
Flanking genome sequence (261290 - 261339)	----+--------+--------+--------+--------+----* TGTTGGCAATCCAAGCTCTGCTGTAGAAGCAGTGGGTTCAACAACCCACC

Features of the protein sequence

Description

Length: 2250 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06719	100.0	DNAH6 variant p...	Homo sapiens
Q9C0G6	100.0	Dynein heavy ch...	Homo sapiens
XP_515578	98.8	similar to SI:z...	Pan troglodytes
XP_001082827	98.1	similar to Dyne...	Macaca mulatta
XP_001916921	93.6	similar to Dyne...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011704	183	330	PF07728	ATPase associated with various cellular activities
HMMPfam	IPR004273	1580	2247	PF03028	Dynein heavy chain
HMMSmart	IPR003593	180	333	SM00382	AAA+ ATPase
HMMSmart	IPR003593	531	689	SM00382	AAA+ ATPase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp