ORK04170

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04170

Order Kazusa clone(s) from :

Accession No	AB208857
Product ID	ORK04170
Clone name	fj15819
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARIH2
cDNA sequence	DNA sequence (1293 bp) Predicted protein sequence (318 aa)
Description	Protein ariadne-2 homolog (ARI-2) (Triad1 protein).

Features of the cloned cDNA sequence

Description

Length: 1293 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	336 bp
Genome contig ID	gi89161205f_48880967
PolyA signal sequence (None)	+--------+--------+----*----+---- AACTTATGTAACTTTCAAAGGTTGTACAATTATAC
Flanking genome sequence (115078 - 115127)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGCAAACTATAGGATAACACAGAGCCCTTTTTGAAA

Features of the protein sequence

Description

Length: 318 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92094	9.5e-139	100.0	ariadne homolog...	Homo sapiens
XP_516447	1.6e-137	99.3	ariadne homolog...	Pan troglodytes
XP_001159626	1.6e-137	99.3	ariadne homolog...	Pan troglodytes
XP_001159494	1.7e-137	99.3	hypothetical pr...	Pan troglodytes
BAE01598	1.7e-137	99.3	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002867	33	95	PF01485	Zinc finger
HMMSmart	IPR002867	33	95	SM00647	Zinc finger
HMMSmart	IPR002867	103	165	SM00647	Zinc finger
ProfileScan	IPR001841	125	165	PS50089	Zinc finger
ScanRegExp	IPR001841	143	152	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp