ORK05305

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05305

Order Kazusa clone(s) from :

Accession No	AB209240
Product ID	ORK05305
Clone name	fj15904
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GMFB
cDNA sequence	DNA sequence (4066 bp) Predicted protein sequence (112 aa)
Description	Glia maturation factor beta (GMF-beta).

Features of the cloned cDNA sequence

Description

Length: 4066 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3726 bp
Genome contig ID	gi51511730r_53910952
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTACTGGTTTAAATAAAATGTTAACATTAAAAGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCCAGCTTTTCTTTTTTTACTCACCTCTTTCCCCCTTTGGAGTTACTGG

Features of the protein sequence

Description

Length: 112 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92477	1.8e-43	100.0	glia maturation...	Homo sapiens
XP_853603	6.4e-34	92.1	similar to Glia...	Canis lupus fam...
EDL20722	2e-24	72.8	glia maturation...	Mus musculus
XP_001085066	7e-23	77.3	glia maturation...	Macaca mulatta
Q5R6P6	7e-23	77.3	Glia maturation...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002108	22	77	PF00241	Actin-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp