ORK06312

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06312

Order Kazusa clone(s) from :

Accession No	AB209241
Product ID	ORK06312
Clone name	fj16183
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PDHB
cDNA sequence	DNA sequence (4459 bp) Predicted protein sequence (164 aa)
Description	Pyruvate dehydrogenase E1 component subunit beta, mitochondrial precursor (EC 1.2.4.1) (PDHE1-B).

Features of the cloned cDNA sequence

Description

Length: 4459 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1319 bp
Genome contig ID	gi89161205r_58288448
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- ATAACTTATATGTATAAAATTAAAGCATATAATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATTTACTGTTAGTTTGTTTTGATAAGGAATAAAGGAATTTCTAACATG

Features of the protein sequence

Description

Length: 164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92478	1.2e-70	100.0	Hypothetical pr...	Homo sapiens
XP_001174187	2.5e-56	95.6	pyruvate dehydr...	Pan troglodytes
EAW65372	3.4e-56	96.3	pyruvate dehydr...	Homo sapiens
AAA60054	3.6e-56	96.3	pyruvate dehydr...	Homo sapiens
CAB56017	3.6e-56	96.3	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005475	22	128	PF02779	Transketolase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2	VCYCLLLFLVFLTSTFLILQAGL	24	PRIMARY	23