Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07603
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290166
Product ID ORK07603
Clone name fj17878y3
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIF21A
cDNA sequence DNA sequence (6601 bp)
Predicted protein sequence (1727 aa)
Description Homo sapiens mRNA for KIF21A/KIAA1708 variant protein
Features of the cloned cDNA sequence

Length: 6601 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1195 bp
Genome contig ID gi89161190r_37873298
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
AGCTAGGGCTTAAATAAACATGTTGCTATGAAATT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATTTTTACTGTATTGTTCTTTTTCCAAATTGCAAGAGAATGGCCAGTGTT

Features of the protein sequence

Length: 1727 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW57803 0 100.0 kinesin family ...
 Homo sapiens
AAP97680 0 99.1 kinesin-like pr...
 Homo sapiens
XP_868987 0 95.6 kinesin family ...
 Bos taurus
EAW57804 0 99.8 kinesin family ...
 Homo sapiens
EAW57802 0 96.2 kinesin family ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001752 145 166 PR00380 Kinesin
IPR001752 283 300 PR00380 Kinesin
IPR001752 387 408 PR00380 Kinesin
IPR001680 1413 1427 PR00320 WD40 repeat
IPR001680 1609 1623 PR00320 WD40 repeat
IPR001680 1692 1706 PR00320 WD40 repeat
HMMPfam IPR001752 81 438 PF00225 Kinesin
IPR001680 1390 1426 PF00400 WD40 repeat
IPR001680 1430 1467 PF00400 WD40 repeat
IPR001680 1494 1531 PF00400 WD40 repeat
IPR001680 1535 1576 PF00400 WD40 repeat
IPR001680 1585 1622 PF00400 WD40 repeat
IPR001680 1627 1665 PF00400 WD40 repeat
IPR001680 1669 1705 PF00400 WD40 repeat
HMMSmart IPR001752 73 445 SM00129 Kinesin
IPR001680 1389 1426 SM00320 WD40 repeat
IPR001680 1429 1467 SM00320 WD40 repeat
IPR001680 1493 1531 SM00320 WD40 repeat
IPR001680 1534 1576 SM00320 WD40 repeat
IPR001680 1584 1622 SM00320 WD40 repeat
IPR001680 1625 1665 SM00320 WD40 repeat
IPR001680 1668 1705 SM00320 WD40 repeat
ProfileScan IPR001752 72 365 PS50067 Kinesin
IPR001680 1396 1435 PS50082 WD40 repeat
IPR001680 1396 1714 PS50294 WD40 repeat
IPR001680 1592 1631 PS50082 WD40 repeat
IPR001680 1633 1668 PS50082 WD40 repeat
IPR001680 1675 1708 PS50082 WD40 repeat
ScanRegExp IPR001752 334 345 PS00411 Kinesin
IPR001680 1413 1427 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp