ORK10420

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10420

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10420
Clone name	fj19988
Vector information	The cDNA fragment was inserted at the NotI-SalI site of the ... The cDNA fragment was inserted at the NotI-SalI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was ligated at the NotI site and the 3' end of the cDNA was inserted at the SalI site of the vector. The adjacent sequences to the cDNA are as follows: 3' end of cDNA-CCCACGCGTC CGCCCACGCG TCCGCGGACG CGTGG.
Symbol	FBXO11
cDNA sequence	DNA sequence (3927 bp) Predicted protein sequence (909 aa)
Description	F-box only protein 11 (Vitiligo-associated protein 1)(VIT-1)

Features of the cloned cDNA sequence

Description

Length: 3927 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1196 bp
Genome contig ID	gi89161199r_47787565
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGTCATTTTTAAAAAATAAAGTTTATTAGATCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTTGTCTGAATTTACCACCTTTGTCAGAAGTCAACTCAAAGCTTCCA

Features of the protein sequence

Description

Length: 909 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86XK2	100.0	F-box only prot...	Homo sapiens
AAH43258	99.8	FBXO11 protein ...	Homo sapiens
AAV87312	99.8	F-box protein 1...	Homo sapiens
XP_001113723	99.6	similar to F-bo...	Macaca mulatta
NP_001074503	98.3	F-box protein 1...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	136	183	PF00646	Cyclin-like F-box
HMMPfam	IPR003126	820	885	PF02207	Zinc finger
HMMSmart	IPR001810	141	181	SM00256	Cyclin-like F-box
	IPR006626	377	399	SM00710	Parallel beta-helix repeat
	IPR006633	400	536	SM00722	Carbohydrate-binding and sugar hydrolysis
	IPR006626	400	422	SM00710	Parallel beta-helix repeat
	IPR006626	423	445	SM00710	Parallel beta-helix repeat
	IPR006626	446	468	SM00710	Parallel beta-helix repeat
	IPR006626	469	491	SM00710	Parallel beta-helix repeat
	IPR006626	492	514	SM00710	Parallel beta-helix repeat
	IPR006626	515	537	SM00710	Parallel beta-helix repeat
	IPR006626	538	560	SM00710	Parallel beta-helix repeat
	IPR006633	552	674	SM00722	Carbohydrate-binding and sugar hydrolysis
	IPR006626	561	583	SM00710	Parallel beta-helix repeat
	IPR006626	584	606	SM00710	Parallel beta-helix repeat
	IPR006626	607	629	SM00710	Parallel beta-helix repeat
	IPR006626	630	652	SM00710	Parallel beta-helix repeat
	IPR006626	653	675	SM00710	Parallel beta-helix repeat
	IPR006626	676	698	SM00710	Parallel beta-helix repeat
	IPR006633	690	819	SM00722	Carbohydrate-binding and sugar hydrolysis
	IPR006626	699	721	SM00710	Parallel beta-helix repeat
	IPR006626	722	744	SM00710	Parallel beta-helix repeat
	IPR006626	745	767	SM00710	Parallel beta-helix repeat
	IPR006626	768	790	SM00710	Parallel beta-helix repeat
	IPR006626	791	812	SM00710	Parallel beta-helix repeat
	IPR013993	820	885	SM00396	Zinc finger
ProfileScan	IPR001810	135	181	PS50181	Cyclin-like F-box
ProfileScan	IPR003126	815	886	PS51157	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp