ORK05770

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05770

Order Kazusa clone(s) from :

Accession No	AB208820
Product ID	ORK05770
Clone name	fj23122
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KLHL5
cDNA sequence	DNA sequence (2925 bp) Predicted protein sequence (593 aa)
Description	Kelch-like protein 5.

Features of the cloned cDNA sequence

Description

Length: 2925 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1141 bp
Genome contig ID	gi89161207f_38653979
PolyA signal sequence (GATAAA,-24)	+--------+--------+----*----+---- TAACATTTTGTGATAAATCCTATAAGATATAAGTC
Flanking genome sequence (146246 - 146295)	----+--------+--------+--------+--------+----* ATTGAGATGTCTAAGATGCTTTTTATTTTAACCCCAGTTAATAACCACCT

Features of the protein sequence

Description

Length: 593 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92057	100.0	kelch-like 5 is...	Homo sapiens
EAW92911	99.6	kelch-like 5 (D...	Homo sapiens
Q96PQ7	99.6	Kelch-like prot...	Homo sapiens
EAW92908	99.6	kelch-like 5 (D...	Homo sapiens
AAH53860	99.6	KLHL5 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	351	364	PR00501	Kelch
	IPR006651	368	382	PR00501	Kelch
	IPR006651	430	442	PR00501	Kelch
HMMPfam	IPR013069	48	155	PF00651	BTB/POZ
	IPR011705	160	261	PF07707	BTB/Kelch-associated
	IPR006652	305	339	PF01344	Kelch repeat type 1
	IPR006652	341	386	PF01344	Kelch repeat type 1
	IPR006652	388	433	PF01344	Kelch repeat type 1
	IPR006652	435	480	PF01344	Kelch repeat type 1
	IPR006652	482	533	PF01344	Kelch repeat type 1
	IPR006652	535	580	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	58	155	SM00225	BTB/POZ-like
	IPR006652	306	352	SM00612	Kelch repeat type 1
	IPR006652	353	399	SM00612	Kelch repeat type 1
	IPR006652	400	446	SM00612	Kelch repeat type 1
	IPR006652	447	493	SM00612	Kelch repeat type 1
	IPR006652	494	546	SM00612	Kelch repeat type 1
	IPR006652	547	593	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	58	125	PS50097	BTB/POZ-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp