ORK02074

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02074

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02074
Clone name	fk00046
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HSPA9
cDNA sequence	DNA sequence (3277 bp) Predicted protein sequence (706 aa)
HaloTag ORF Clone	FHC02074
Flexi ORF Clone	FXC02074
Description	Stress-70 protein, mitochondrial precursor (75 kDa glucose-regulated protein) (GRP 75) (Heat shock 70 kDa protein 9) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT).

Features of the cloned cDNA sequence

Description

Length: 3277 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1154 bp
Genome contig ID	gi51511721r_137818471
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GCTCAAAAATAAAAGGAACCCAGATTTCTTTCCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTGCTTTTCTGTCCTCAGTGTACTGGCTTGTCCCAAATTCTCTGAT

Features of the protein sequence

Description

Length: 706 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P38646	100.0	Stress-70 prote...	Homo sapiens
XP_001171426	99.8	heat shock 70kD...	Pan troglodytes
BAG37618	99.8	unnamed protein...	Homo sapiens
AAA67526	99.8	MTHSP75 [Homo s...	Homo sapiens
XP_001113234	99.5	heat shock 70kD...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013126	148	240	PD000089	Heat shock protein 70
FPrintScan	IPR001023	81	94	PR00301	Heat shock protein Hsp70
	IPR001023	109	121	PR00301	Heat shock protein Hsp70
	IPR001023	132	140	PR00301	Heat shock protein Hsp70
	IPR001023	216	236	PR00301	Heat shock protein Hsp70
	IPR001023	275	285	PR00301	Heat shock protein Hsp70
	IPR001023	407	423	PR00301	Heat shock protein Hsp70
	IPR001023	438	458	PR00301	Heat shock protein Hsp70
	IPR001023	461	480	PR00301	Heat shock protein Hsp70
	IPR001023	542	558	PR00301	Heat shock protein Hsp70
HMMPfam	IPR013126	82	680	PF00012	Heat shock protein 70
HMMTigr	IPR012725	81	680	TIGR02350	Chaperone DnaK
ScanRegExp	IPR013126	85	92	PS00297	Heat shock protein 70
	IPR002048	260	272	PS00018	Calcium-binding EF-hand
	IPR013126	269	282	PS00329	Heat shock protein 70
	IPR013126	410	424	PS01036	Heat shock protein 70

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	IAQLFAVGALVCCLVLLHLSAMI	29	PRIMARY	23