ORK01730

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01730

Order Kazusa clone(s) from :

Accession No	AK226106
Product ID	ORK01730
Clone name	fk00416
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LRSAM1
cDNA sequence	DNA sequence (3115 bp) Predicted protein sequence (731 aa)
HaloTag ORF Clone	FHC01730
Flexi ORF Clone	FXC01730
Description	E3 ubiquitin-protein ligase LRSAM1 (EC 6.3.2.-) (Leucine-rich repeat and sterile alpha motif-containing protein 1) (Tsg101-associated ligase) (hTAL).

Features of the cloned cDNA sequence

Description

Length: 3115 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	598 bp
Genome contig ID	gi89161216f_129153613
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCGAAGCAGGAGTGTCAATAAACCTGTCTTCAGTG
Flanking genome sequence (151986 - 152035)	----+--------+--------+--------+--------+----* CGCTTCTGGCCTGAGTCATCACTGGGTTCTCATGGGAGCCCAGGGAGGGG

Features of the protein sequence

Description

Length: 731 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10635	2.2e-208	100.0	E3 ubiquitin-pr...	synthetic construct
AAH09239	4.2e-208	99.8	Leucine rich re...	Homo sapiens
Q6UWE0	7.9e-208	99.7	E3 ubiquitin-pr...	Homo sapiens
BAC03703	8.8e-208	99.5	unnamed protein...	Homo sapiens
XP_001149113	2e-205	98.7	leucine rich re...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	91	104	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	157	170	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	90	111	PF00560	Leucine-rich repeat
	IPR001611	113	134	PF00560	Leucine-rich repeat
	IPR001611	136	157	PF00560	Leucine-rich repeat
	IPR001611	159	177	PF00560	Leucine-rich repeat
	IPR011510	581	640	PF07647	Sterile alpha motif homology 2
HMMSmart	NULL	88	107	SM00364	NULL
	IPR003591	88	110	SM00369	Leucine-rich repeat
	IPR003591	111	133	SM00369	Leucine-rich repeat
	NULL	111	130	SM00364	NULL
	IPR003591	134	155	SM00369	Leucine-rich repeat
	NULL	134	153	SM00364	NULL
	NULL	157	176	SM00364	NULL
	IPR003591	157	179	SM00369	Leucine-rich repeat
	IPR001660	574	640	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	586	640	PS50105	Sterile alpha motif SAM
ProfileScan	IPR001841	683	718	PS50089	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp