ORK07116

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07116

Order Kazusa clone(s) from :

Accession No	AB209260
Product ID	ORK07116
Clone name	fk00733
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TIAL1
cDNA sequence	DNA sequence (3112 bp) Predicted protein sequence (183 aa)
Description	Nucleolysin TIAR (TIA-1-related protein).

Features of the cloned cDNA sequence

Description

Length: 3112 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	823 bp
Genome contig ID	gi89161187r_121224886
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGACAATTCTGACTACAAATTTTGATATAATAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATGGCTAATACATTTTGATTCTTAGATACTATTCCATTTTTATCTT

Features of the protein sequence

Description

Length: 183 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92497	5.4e-79	100.0	TIA1 cytotoxic ...	Homo sapiens
BAG58235	1.6e-77	98.8	unnamed protein...	Homo sapiens
BAA21559	3e-77	99.4	T-cluster bindi...	Homo sapiens
EAW49386	3.1e-77	99.4	TIA1 cytotoxic ...	Homo sapiens
XP_865170	1.6e-76	97.7	similar to TIA1...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	3	49	PF00076	RNA recognition motif
HMMPfam	IPR000504	86	151	PF00076	RNA recognition motif
HMMSmart	IPR000504	1	50	SM00360	RNA recognition motif
HMMSmart	IPR000504	85	152	SM00360	RNA recognition motif
ProfileScan	IPR000504	1	54	PS50102	RNA recognition motif
ProfileScan	IPR000504	84	156	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp