ORK05320

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05320

Order Kazusa clone(s) from :

Accession No	AK226129
Product ID	ORK05320
Clone name	fk00939
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ERCC8
cDNA sequence	DNA sequence (3556 bp) Predicted protein sequence (303 aa)
Description	Guanine nucleotide-binding protein-like 3-like protein.

Features of the cloned cDNA sequence

Description

Length: 3556 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2428 bp
Genome contig ID	gi51511721r_60105418
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGAAATGCTGTAATAAAATTTCTATGTTATTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCGTCTGTGTCAACCCACACGTGATTATCATGAAGGTAATCTTAATTTT

Features of the protein sequence

Description

Length: 303 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG51829	9.3e-52	96.1	unnamed protein...	Homo sapiens
BAG65395	1e-51	96.1	unnamed protein...	Homo sapiens
Q13216	1e-51	96.1	DNA excision re...	Homo sapiens
AAX36967	1e-51	96.1	Cockayne syndro...	synthetic construct
AAV38845	1e-51	96.1	Cockayne syndro...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	59	93	PD000018	WD40 repeat
FPrintScan	IPR001680	79	93	PR00320	WD40 repeat
FPrintScan	IPR001680	137	151	PR00320	WD40 repeat
HMMPfam	IPR001680	53	92	PF00400	WD40 repeat
HMMPfam	IPR001680	112	150	PF00400	WD40 repeat
HMMSmart	IPR001680	52	92	SM00320	WD40 repeat
HMMSmart	IPR001680	111	150	SM00320	WD40 repeat
ProfileScan	IPR001680	59	94	PS50082	WD40 repeat
	IPR001680	59	159	PS50294	WD40 repeat
	IPR001680	118	159	PS50082	WD40 repeat
ScanRegExp	IPR001680	79	93	PS00678	WD40 repeat
ScanRegExp	IPR001680	137	151	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp