ORK04626

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04626

Order Kazusa clone(s) from :

Accession No	AB209262
Product ID	ORK04626
Clone name	fk01315
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CREB5
cDNA sequence	DNA sequence (3310 bp) Predicted protein sequence (368 aa)
Description	cAMP response element-binding protein 5 (CRE-BPa).

Features of the cloned cDNA sequence

Description

Length: 3310 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2202 bp
Genome contig ID	gi89161213f_28592295
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTGAAGAATCAAAACAAAAGCAAAAAAAAAAAGC
Flanking genome sequence (235323 - 235372)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAGAGAAAAAAAGAAAAAATGCAAATGGAATAATTTTCTA

Features of the protein sequence

Description

Length: 368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92499	7.3e-117	100.0	cAMP responsive...	Homo sapiens
AAH59400	7.3e-117	100.0	CAMP responsive...	Homo sapiens
AAC37527	2.2e-116	99.4	cAMP responsive...	Homo sapiens
Q8K1L0	1.4e-112	99.1	Cyclic AMP-resp...	Mus musculus
AAH98487	4.3e-112	98.8	CAMP responsive...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011616	232	297	PF00170	bZIP transcription factor
HMMSmart	IPR004827	233	297	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	IPR004827	235	298	PS50217	Basic-leucine zipper (bZIP) transcription factor
ScanRegExp	IPR004827	240	255	PS00036	Basic-leucine zipper (bZIP) transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp