ORK06521

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06521

Order Kazusa clone(s) from :

Accession No	AB209266
Product ID	ORK06521
Clone name	fk02476
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTBP2
cDNA sequence	DNA sequence (3606 bp) Predicted protein sequence (177 aa)
Description	Polypyrimidine tract-binding protein 2 (Neurally-enriched homolog of PTB) (Neural polypyrimidine tract-binding protein) (PTB-like protein).

Features of the cloned cDNA sequence

Description

Length: 3606 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3072 bp
Genome contig ID	gi89161185f_96859943
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTTCAGCCTGGGCGACAGAGCGAGACTCTGTCTC
Flanking genome sequence (152165 - 152214)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGAATTCCTGGTACCAGCAGGGCACTTTGGCTC

Features of the protein sequence

Description

Length: 177 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92503	4.9e-70	100.0	polypyrimidine ...	Homo sapiens
BAB71743	7.2e-55	100.0	PTB-like protei...	Homo sapiens
Q9UKA9	1e-54	100.0	Polypyrimidine ...	Homo sapiens
BAB71742	1e-54	100.0	PTB-like protei...	Homo sapiens
AAM94625	1e-54	100.0	non-neuronal sp...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000504	82	151	SM00360	RNA recognition motif
ProfileScan	IPR000504	81	155	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp