ORK07612

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07612

Order Kazusa clone(s) from :

Accession No	AK226101
Product ID	ORK07612
Clone name	fk03978
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RASGRF1
cDNA sequence	DNA sequence (3566 bp) Predicted protein sequence (1143 aa)
Description	Homo sapiens mRNA for Ras protein-specific guanine nucleotide-releasing factor 1 isoform 1 variant, clone: fk03978.

Features of the cloned cDNA sequence

Description

Length: 3566 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	133 bp
Genome contig ID	gi51511731r_76941408
PolyA signal sequence (AATACA,-24)	+--------+--------+----*----+---- GCTTCTCCAAGAATACAAATCGTCCTTGTTCTTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCCTGTAGAACCGGAATATGAATTTCTGCACCGTTTCAGACTTCGCCC

Features of the protein sequence

Description

Length: 1143 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11048	100.0	Ras protein-spe...	synthetic construct
XP_001488192	98.0	Ras protein-spe...	Equus caballus
XP_545892	93.0	similar to Ras ...	Canis lupus fam...
AAH40275	99.8	RASGRF1 protein...	Homo sapiens
XP_001153395	99.5	Ras protein-spe...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	89	109	PF00612	IQ calmodulin-binding region
	IPR000219	130	311	PF00621	DH
	IPR001849	343	470	PF00169	Pleckstrin-like
	IPR000651	520	852	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	905	1090	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR000219	130	311	SM00325	DH
	IPR001849	343	472	SM00233	Pleckstrin-like
	IPR000651	516	652	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR000651	751	878	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	904	1141	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR000048	90	115	PS50096	IQ calmodulin-binding region
	IPR000219	126	312	PS50010	DH
	IPR001849	353	470	PS50003	Pleckstrin-like
	IPR000651	517	632	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	908	1140	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001331	260	285	PS00741	Guanine-nucleotide dissociation stimulator
ScanRegExp	IPR001895	1057	1087	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp