ORK07333

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07333

Order Kazusa clone(s) from :

Accession No	AB208822
Product ID	ORK07333
Clone name	fk04727
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	VLDLR
cDNA sequence	DNA sequence (3262 bp) Predicted protein sequence (555 aa)
Description	Very low-density lipoprotein receptor precursor (VLDL receptor) (VLDL- R).

Features of the cloned cDNA sequence

Description

Length: 3262 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1593 bp
Genome contig ID	gi89161216f_2512172
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AGTGCTAAAAAATTAAACCAAGCAGCTTAACCATG
Flanking genome sequence (132315 - 132364)	----+--------+--------+--------+--------+----* GTTTGTGCCTGTTCCTCTAGGATGAACTCCTATCCTGAGTAGTACCAAGT

Features of the protein sequence

Description

Length: 555 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92059	0	100.0	Very low-densit...	Homo sapiens
BAA03946	5.4e-204	100.0	very low densit...	Homo sapiens
P98155	5.5e-204	100.0	Very low-densit...	Homo sapiens
AAA61344	9.3e-204	99.7	very low densit...	Homo sapiens
AAA53684	2.7e-203	99.5	very low densit...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002172	100	121	PR00261	Low density lipoprotein-receptor
	IPR002172	139	160	PR00261	Low density lipoprotein-receptor
	IPR002172	182	203	PR00261	Low density lipoprotein-receptor
	IPR002172	221	242	PR00261	Low density lipoprotein-receptor
	IPR002172	260	281	PR00261	Low density lipoprotein-receptor
	IPR002172	306	327	PR00261	Low density lipoprotein-receptor
HMMPfam	IPR002172	88	124	PF00057	Low density lipoprotein-receptor
	IPR002172	127	165	PF00057	Low density lipoprotein-receptor
	IPR002172	168	206	PF00057	Low density lipoprotein-receptor
	IPR002172	209	245	PF00057	Low density lipoprotein-receptor
	IPR002172	248	286	PF00057	Low density lipoprotein-receptor
	IPR002172	294	330	PF00057	Low density lipoprotein-receptor
	IPR002172	333	369	PF00057	Low density lipoprotein-receptor
	IPR002172	373	412	PF00057	Low density lipoprotein-receptor
	IPR006209	417	451	PF00008	EGF-like
	IPR013091	453	491	PF07645	EGF calcium-binding
HMMSmart	IPR006210	89	125	SM00181	EGF
	IPR002172	89	126	SM00192	Low density lipoprotein-receptor
	IPR006210	128	166	SM00181	EGF
	IPR002172	128	167	SM00192	Low density lipoprotein-receptor
	IPR002172	169	208	SM00192	Low density lipoprotein-receptor
	IPR002172	210	247	SM00192	Low density lipoprotein-receptor
	IPR006210	210	246	SM00181	EGF
	IPR002172	249	288	SM00192	Low density lipoprotein-receptor
	IPR002172	295	332	SM00192	Low density lipoprotein-receptor
	IPR002172	334	371	SM00192	Low density lipoprotein-receptor
	IPR002172	374	414	SM00192	Low density lipoprotein-receptor
	IPR001881	413	452	SM00179	EGF-like calcium-binding
	IPR006210	416	452	SM00181	EGF
	IPR001881	453	492	SM00179	EGF-like calcium-binding
	IPR006210	456	492	SM00181	EGF
ProfileScan	IPR002172	89	125	PS50068	Low density lipoprotein-receptor
	IPR002172	128	166	PS50068	Low density lipoprotein-receptor
	IPR002172	169	207	PS50068	Low density lipoprotein-receptor
	IPR002172	210	246	PS50068	Low density lipoprotein-receptor
	IPR002172	249	287	PS50068	Low density lipoprotein-receptor
	IPR002172	295	331	PS50068	Low density lipoprotein-receptor
	IPR002172	334	370	PS50068	Low density lipoprotein-receptor
	IPR002172	374	413	PS50068	Low density lipoprotein-receptor
	IPR000742	413	452	PS50026	EGF-like
	IPR000742	453	488	PS50026	EGF-like
ScanRegExp	IPR002172	102	124	PS01209	Low density lipoprotein-receptor
	IPR002172	141	165	PS01209	Low density lipoprotein-receptor
	IPR002172	184	206	PS01209	Low density lipoprotein-receptor
	IPR002172	223	245	PS01209	Low density lipoprotein-receptor
	IPR002172	262	286	PS01209	Low density lipoprotein-receptor
	IPR002172	308	330	PS01209	Low density lipoprotein-receptor
	IPR002172	347	369	PS01209	Low density lipoprotein-receptor
	IPR002172	388	412	PS01209	Low density lipoprotein-receptor
	IPR000152	428	439	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	437	451	PS01186	EGF-like region
	IPR001881	453	476	PS01187	EGF-like calcium-binding
	IPR000152	467	478	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	476	491	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	55	AGTMGTSALWALWLLLALCWAP	76	PRIMARY	22