ORK11818

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11818

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11818
Clone name	fk05554
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF282
cDNA sequence	DNA sequence (3553 bp) Predicted protein sequence (675 aa)
HaloTag ORF Clone	FHC11818
Flexi ORF Clone	FXC11818
Description	Zinc finger protein 282 (HTLV-I U5RE-binding protein 1)(HUB-1)

Features of the cloned cDNA sequence

Description

Length: 3553 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1525 bp
Genome contig ID	gi89161213f_148423603
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AATTCTTGACATTAAATAAAAGGTATCCAGATTGC
Flanking genome sequence (130595 - 130644)	----+--------+--------+--------+--------+----* AGACTGCATGTTCACAGAGCTGGGGGTTCTCCAGCTTGCCTACAGTAAAG

Features of the protein sequence

Description

Length: 675 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAA24380	8.9e-195	99.5	repressor prote...	Homo sapiens
Q9UDV7	2.3e-194	99.8	Zinc finger pro...	Homo sapiens
EAW80055	4e-194	99.7	zinc finger pro...	Homo sapiens
XP_001166690	4.9e-194	99.7	zinc finger pro...	Pan troglodytes
EAW80056	1.3e-193	99.5	zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	522	545	PD000003	Zinc finger
	IPR007087	550	572	PD000003	Zinc finger
	IPR007087	578	601	PD000003	Zinc finger
	IPR007087	606	629	PD000003	Zinc finger
	IPR007087	634	657	PD000003	Zinc finger
HMMPfam	IPR001909	202	242	PF01352	KRAB box
	IPR007087	522	544	PF00096	Zinc finger
	IPR007087	550	572	PF00096	Zinc finger
	IPR007087	578	600	PF00096	Zinc finger
	IPR007087	606	628	PF00096	Zinc finger
	IPR007087	634	656	PF00096	Zinc finger
HMMSmart	IPR001909	202	264	SM00349	KRAB box
	IPR015880	522	544	SM00355	Zinc finger
	IPR015880	550	572	SM00355	Zinc finger
	IPR015880	578	600	SM00355	Zinc finger
	IPR015880	606	628	SM00355	Zinc finger
	IPR015880	634	656	SM00355	Zinc finger
ProfileScan	IPR001909	202	275	PS50805	KRAB box
	IPR007087	522	549	PS50157	Zinc finger
	IPR007087	550	577	PS50157	Zinc finger
	IPR007087	578	605	PS50157	Zinc finger
	IPR007087	606	633	PS50157	Zinc finger
	IPR007087	634	661	PS50157	Zinc finger
ScanRegExp	IPR007087	524	544	PS00028	Zinc finger
	IPR007087	552	572	PS00028	Zinc finger
	IPR007087	580	600	PS00028	Zinc finger
	IPR007087	608	628	PS00028	Zinc finger
	IPR007087	636	656	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp