ORK01370

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01370

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01370
Clone name	fk05619
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UBA1
cDNA sequence	DNA sequence (3400 bp) Predicted protein sequence (1119 aa)
HaloTag ORF Clone	FHC01370
Flexi ORF Clone	FXC01370
Description	Ubiquitin-activating enzyme E1 (A1S9 protein).

Features of the cloned cDNA sequence

Description

Length: 3400 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	38 bp
Genome contig ID	gi89161218f_46838183
PolyA signal sequence (None)	+--------+--------+----*----+---- CGTCTGCTCCTCTAGGCTGGCCCCTTGTCCACCCC
Flanking genome sequence (121129 - 121178)	----+--------+--------+--------+--------+----* TCTCCACACCCCTTCCAGCCCAGGGTTCCCATTTGGCTTCTGGCAGTGGC

Features of the protein sequence

Description

Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P22314	100.0	Ubiquitin-like ...	Homo sapiens
AAP36419	100.0	ubiquitin-activ...	synthetic construct
CAA40296	99.8	ubiquitin activ...	Homo sapiens
XP_001092142	98.6	similar to ubiq...	Macaca mulatta
XP_001492997	97.6	ubiquitin-like ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000011	137	161	PR01849	Ubiquitin-activating enzyme
	IPR000011	250	277	PR01849	Ubiquitin-activating enzyme
	IPR000011	559	582	PR01849	Ubiquitin-activating enzyme
	IPR000011	606	631	PR01849	Ubiquitin-activating enzyme
	IPR000011	759	786	PR01849	Ubiquitin-activating enzyme
HMMPfam	IPR000594	132	263	PF00899	UBA/THIF-type NAD/FAD binding fold
	IPR000594	528	671	PF00899	UBA/THIF-type NAD/FAD binding fold
	IPR000127	814	876	PF02134	Ubiquitin-activating enzyme repeat
	IPR000127	909	981	PF02134	Ubiquitin-activating enzyme repeat
HMMTigr	IPR000011	110	1119	TIGR01408	Ubiquitin-activating enzyme
ScanRegExp	IPR000011	472	480	PS00536	Ubiquitin-activating enzyme
ScanRegExp	IPR000011	691	699	PS00865	Ubiquitin-activating enzyme

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	949	GKIIPAIATTTAAVVGLVCLELY	971	PRIMARY	23
SOSUI2	2	1047	EITMLSQGVSMLYSFFMPAAK	1067	SECONDARY	21