ORK05756

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05756

Order Kazusa clone(s) from :

Accession No
Product ID	ORK05756
Clone name	fk06330
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KLF7
cDNA sequence	DNA sequence (3401 bp) Predicted protein sequence (324 aa)
HaloTag ORF Clone	FHC05756
Flexi ORF Clone	FXC05756
Description	Kruppel-like factor 7 (ubiquitous)

Features of the cloned cDNA sequence

Description

Length: 3401 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2114 bp
Genome contig ID	gi89161199r_207552067
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTACTTTCTCCTTTTCCTTTTTTCTATTTAGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAACAAAAACAAAAACAAAAAAAAAAACAAAATAATACAAAACGA

Features of the protein sequence

Description

Length: 324 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL00198	7.4e-122	97.1	Kruppel-like fa...	Mus musculus
O75840	1e-119	100.0	Krueppel-like f...	Homo sapiens
AAV38393	1e-119	100.0	Kruppel-like fa...	synthetic construct
BAG51308	1.8e-119	99.6	unnamed protein...	Homo sapiens
XP_001106942	2.1e-119	99.6	similar to Krup...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	271	296	PD000003	Zinc finger
BlastProDom	IPR007087	301	323	PD000003	Zinc finger
HMMPfam	IPR007087	241	265	PF00096	Zinc finger
	IPR007087	271	295	PF00096	Zinc finger
	IPR007087	301	323	PF00096	Zinc finger
HMMSmart	IPR015880	241	265	SM00355	Zinc finger
	IPR015880	271	295	SM00355	Zinc finger
	IPR015880	301	323	SM00355	Zinc finger
ProfileScan	IPR007087	241	270	PS50157	Zinc finger
	IPR007087	271	300	PS50157	Zinc finger
	IPR007087	301	324	PS50157	Zinc finger
ScanRegExp	IPR007087	243	265	PS00028	Zinc finger
	IPR007087	273	295	PS00028	Zinc finger
	IPR007087	303	323	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp