ORK04041

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04041

Order Kazusa clone(s) from :

Accession No	AB209515
Product ID	ORK04041
Clone name	fk08969
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADAMTS10
cDNA sequence	DNA sequence (3423 bp) Predicted protein sequence (847 aa)
Description	ADAMTS-10 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase with thrombospondin motifs 10) (ADAM-TS 10) (ADAM-TS10).

Features of the cloned cDNA sequence

Description

Length: 3423 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi42406306r_8455847
PolyA signal sequence (None)	+--------+--------+----*----+---- ACGGGCCAGGCGTCGCACGAGTGCACGGAGGCCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCGGCCGCCCACCACGCAGCAGTGTGAGGCCAAGTGCGACAGCCCAACCC

Features of the protein sequence

Description

Length: 847 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92752	100.0	a disintegrin-l...	Homo sapiens
Q9H324	94.0	A disintegrin a...	Homo sapiens
NP_112219	94.0	ADAM metallopep...	Homo sapiens
EAW68907	94.0	ADAM metallopep...	Homo sapiens
EAW68908	94.0	ADAM metallopep...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	310	328	PR01857	Peptidase M12B
	IPR013273	420	439	PR01857	Peptidase M12B
	IPR013273	440	459	PR01857	Peptidase M12B
HMMPfam	IPR001590	107	211	PF01421	Peptidase M12B
	IPR000884	305	355	PF00090	Thrombospondin
	IPR010294	460	572	PF05986	ADAM-TS Spacer 1
	IPR000884	583	638	PF00090	Thrombospondin
	IPR000884	642	698	PF00090	Thrombospondin
HMMSmart	IPR000884	304	356	SM00209	Thrombospondin
	IPR000884	582	639	SM00209	Thrombospondin
	IPR000884	641	694	SM00209	Thrombospondin
	IPR000884	749	806	SM00209	Thrombospondin
	IPR000884	809	845	SM00209	Thrombospondin
ProfileScan	IPR001590	25	211	PS50215	Peptidase M12B
	IPR000884	301	356	PS50092	Thrombospondin
	IPR000884	579	637	PS50092	Thrombospondin
	IPR000884	638	699	PS50092	Thrombospondin
	IPR000884	806	845	PS50092	Thrombospondin
ScanRegExp	IPR006025	143	152	PS00142	Peptidase M

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp