ORK04036

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04036

Order Kazusa clone(s) from :

Accession No	AB209521
Product ID	ORK04036
Clone name	fk09725
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ACTN2
cDNA sequence	DNA sequence (3621 bp) Predicted protein sequence (664 aa)
Description	Alpha-actinin-2 (Alpha actinin skeletal muscle isoform 2) (F-actin cross-linking protein).

Features of the cloned cDNA sequence

Description

Length: 3621 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	575 bp
Genome contig ID	gi89161185f_234816432
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGGAACTGCCGGGGATTAAAAAGACTACCCAAAAG
Flanking genome sequence (176687 - 176736)	----+--------+--------+--------+--------+----* ATTTTTGGCACTTACAATTTTTAAAATAGTTTATGTCATCTCTTCATTAT

Features of the protein sequence

Description

Length: 664 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92758	100.0	actinin, alpha ...	Homo sapiens
XP_001097696	99.5	similar to acti...	Macaca mulatta
P35609	97.0	Alpha-actinin-2...	Homo sapiens
EAW70065	97.0	actinin, alpha ...	Homo sapiens
XP_001097795	96.7	similar to acti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	521	588	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002017	51	161	PF00435	Spectrin repeat
	IPR002017	171	276	PF00435	Spectrin repeat
	IPR002017	286	397	PF00435	Spectrin repeat
	IPR002017	407	510	PF00435	Spectrin repeat
	IPR002048	527	555	PF00036	Calcium-binding EF-hand
	IPR002048	563	591	PF00036	Calcium-binding EF-hand
	IPR014837	594	660	PF08726	EF-hand
HMMSmart	IPR002017	174	275	SM00150	Spectrin repeat
	IPR002017	289	396	SM00150	Spectrin repeat
	IPR002017	410	509	SM00150	Spectrin repeat
	IPR002048	527	555	SM00054	Calcium-binding EF-hand
	IPR002048	563	591	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	523	558	PS50222	Calcium-binding EF-hand
ProfileScan	IPR002048	559	594	PS50222	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp