ORK01414

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01414

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01414
Clone name	fk09741
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPB41L2
cDNA sequence	DNA sequence (3369 bp) Predicted protein sequence (676 aa)
HaloTag ORF Clone	FHC01414
Flexi ORF Clone	FXC01414
Description	erythrocyte membrane protein band 4.1-like 2

Features of the cloned cDNA sequence

Description

Length: 3369 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1254 bp
Genome contig ID	gi89161210r_131102183
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAATACTATTATAAAATAAAGTTTGTTTATTCTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTGTCACTTCTCTTTTTCTAAAGGGTTAAAAAAACAAACTTGAGTG

Features of the protein sequence

Description

Length: 676 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92759	0	100.0	EPB41L2 protein...	Homo sapiens
BAG10820	0	100.0	band 4.1-like p...	synthetic construct
AAH34718	1.2e-211	99.8	EPB41L2 protein...	Homo sapiens
CAH18118	1.7e-211	90.0	hypothetical pr...	Homo sapiens
O43491	2.1e-211	100.0	Band 4.1-like p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	234	253	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	254	266	PR00935	Band 4.1
	IPR000798	284	303	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	318	331	PR00935	Band 4.1
	IPR000798	327	348	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	331	351	PR00935	Band 4.1
	IPR000299	392	408	PR00935	Band 4.1
	IPR000798	415	435	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	223	412	PF00373	Band 4.1
	IPR014847	507	553	PF08736	FERM adjacent (FA)
	IPR008379	562	670	PF05902	Band 4.1
HMMSmart	IPR000299	217	412	SM00295	Band 4.1
ProfileScan	IPR000299	221	502	PS50057	Band 4.1
ScanRegExp	IPR000299	275	303	PS00660	Band 4.1
ScanRegExp	IPR000299	382	411	PS00661	Band 4.1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp