ORK04581

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04581

Order Kazusa clone(s) from :

Accession No	AB209535
Product ID	ORK04581
Clone name	fk11053
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CLK3
cDNA sequence	DNA sequence (3597 bp) Predicted protein sequence (432 aa)
Description	Dual specificity protein kinase CLK3 (EC 2.7.12.1) (CDC-like kinase 3).

Features of the cloned cDNA sequence

Description

Length: 3597 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	233 bp
Genome contig ID	gi51511731f_72598594
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TATAAAGTTATAATAAAGTGTTTCTTACTGTTTGT
Flanking genome sequence (110918 - 110967)	----+--------+--------+--------+--------+----* AACCCCTGGTACCAGTGTGTCCATCTCCAGGCTCCTTGCCTTCCCCTTAC

Features of the protein sequence

Description

Length: 432 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92772	6.1e-180	100.0	dual specificit...	Homo sapiens
XP_001136703	6.1e-180	100.0	CDC-like kinase...	Pan troglodytes
BAG53559	2.8e-173	100.0	unnamed protein...	Homo sapiens
XP_535541	1.6e-156	100.0	similar to Dual...	Canis lupus fam...
XP_001136940	2e-149	100.0	CDC-like kinase...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	104	308	PD000001	Protein kinase
HMMPfam	IPR000719	98	414	PF00069	Protein kinase
HMMSmart	IPR001245	98	414	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	98	414	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	98	414	PS50011	Protein kinase
ScanRegExp	IPR000719	104	128	PS00107	Protein kinase
ScanRegExp	IPR008271	221	233	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	RVPCNIPIVIYAVCLMKCWDLEN	23	PRIMARY	23