ORK04787

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04787

Order Kazusa clone(s) from :

Accession No	AB209536
Product ID	ORK04787
Clone name	fk11077
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DLG1
cDNA sequence	DNA sequence (3759 bp) Predicted protein sequence (687 aa)
Description	Disks large homolog 1 (Synapse-associated protein 97) (SAP-97) (hDlg).

Features of the cloned cDNA sequence

Description

Length: 3759 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1695 bp
Genome contig ID	gi89161205r_198154196
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGGAGAACAGCTAATAAACTGTATTGTAAAATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGTTAAGTGTGTCTTGAATTTTGAAAGAAAAAATATATTTTGCAAGC

Features of the protein sequence

Description

Length: 687 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92773	100.0	presynaptic pro...	Homo sapiens
XP_001166292	99.8	synapse-associa...	Pan troglodytes
BAG57902	99.8	unnamed protein...	Homo sapiens
XP_001479242	97.9	similar to Disc...	Mus musculus
EDM11457	96.9	discs, large ho...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	356	414	PD000066	Src homology-3
FPrintScan	IPR001452	355	365	PR00452	Src homology-3
	IPR001452	374	389	PR00452	Src homology-3
	IPR001452	391	400	PR00452	Src homology-3
HMMPfam	IPR001478	1	79	PF00595	PDZ/DHR/GLGF
	IPR001478	90	174	PF00595	PDZ/DHR/GLGF
	IPR001478	237	315	PF00595	PDZ/DHR/GLGF
	IPR001452	355	398	PF00018	Src homology-3
	IPR008144	530	632	PF00625	Guanylate kinase
HMMSmart	IPR001478	3	82	SM00228	PDZ/DHR/GLGF
	IPR001478	98	177	SM00228	PDZ/DHR/GLGF
	IPR001478	245	318	SM00228	PDZ/DHR/GLGF
	IPR001452	355	421	SM00326	Src homology-3
	IPR008145	496	675	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR001478	1	82	PS50106	PDZ/DHR/GLGF
	IPR001478	90	177	PS50106	PDZ/DHR/GLGF
	IPR001478	237	318	PS50106	PDZ/DHR/GLGF
	IPR001452	352	422	PS50002	Src homology-3
	IPR008144	497	672	PS50052	Guanylate kinase
ScanRegExp	IPR008144	529	546	PS00856	Guanylate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp