ORK07182

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07182

Order Kazusa clone(s) from :

Accession No	AB209541
Product ID	ORK07182
Clone name	fk11476
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TOLLIP
cDNA sequence	DNA sequence (3361 bp) Predicted protein sequence (352 aa)
Description	Toll-interacting protein.

Features of the cloned cDNA sequence

Description

Length: 3361 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2290 bp
Genome contig ID	gi51511727r_1152178
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAAATAGAGAAATAAAGTCCTTTAAGGGAAGGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCATGTTTGTTCCCGAGTATTTTTTAACTTAATTCACAATACGCAGGAG

Features of the protein sequence

Description

Length: 352 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92778	1e-144	100.0	toll interactin...	Homo sapiens
Q9H0E2	1.1e-104	98.5	Toll-interactin...	Homo sapiens
BAE91749	2.4e-104	98.1	unnamed protein...	Macaca fascicularis
CAB58118	1.3e-103	98.1	TOLLIP protein ...	Homo sapiens
A2RUW1	7.7e-99	91.8	Toll-interactin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	86	166	PF00168	C2 calcium-dependent membrane targeting
HMMPfam	IPR003892	260	302	PF02845	Ubiquitin system component Cue
HMMSmart	IPR000008	85	182	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR003892	260	302	SM00546	Ubiquitin system component Cue
ProfileScan	IPR003892	260	303	PS51140	Ubiquitin system component Cue

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp