ORK05542

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05542

Order Kazusa clone(s) from :

Accession No	AB209552
Product ID	ORK05542
Clone name	fk12931
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITGA2B
cDNA sequence	DNA sequence (3189 bp) Predicted protein sequence (551 aa)
Description	Integrin alpha-IIb precursor (Platelet membrane glycoprotein IIb) (GPalpha IIb) (GPIIb) (CD41 antigen) [Contains: Integrin alpha-IIb heavy chain; Integrin alpha-IIb light chain, form 1; Integrin alpha- IIb light chain, form 2].

Features of the cloned cDNA sequence

Description

Length: 3189 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1532 bp
Genome contig ID	gi51511734r_39707090
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCTTGGGCAACAGAGCGAGCCTCCATCTC
Flanking genome sequence (99728 - 99679)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAAAAAAATAGAATGTCTTTCTCTAGTAGAGCAAAAAAGG

Features of the protein sequence

Description

Length: 551 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92789	0	100.0	Integrin alpha-...	Homo sapiens
EAW51594	0	99.8	integrin, alpha...	Homo sapiens
XP_511551	0	99.4	integrin alpha ...	Pan troglodytes
BAG37735	1.4e-202	100.0	unnamed protein...	Homo sapiens
AAI17444	1.4e-202	100.0	Integrin, alpha...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000413	46	67	PR01185	Integrins alpha chain
	IPR000413	73	92	PR01185	Integrins alpha chain
	IPR000413	189	202	PR01185	Integrins alpha chain
HMMPfam	IPR013517	46	77	PF01839	FG-GAP
HMMPfam	IPR013649	79	510	PF08441	Integrin alpha-2
HMMSmart	IPR013519	42	93	SM00191	Integrin alpha beta-propellor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp