ORK07621

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07621

Order Kazusa clone(s) from :

Accession No	AB290168
Product ID	ORK07621
Clone name	fk13965y2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNAH10
cDNA sequence	DNA sequence (10192 bp) Predicted protein sequence (3319 aa)
Description	Homo sapiens mRNA for DNAH10/KIAA2017 variant protein

Features of the cloned cDNA sequence

Description

Length: 10192 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	232 bp
Genome contig ID	gi89161190f_122769480
PolyA signal sequence (AGTAAA,-17)	+--------+--------+----*----+---- GAATTTATATAATCAAAAAGTAAATATTGGAGAGT
Flanking genome sequence (216735 - 216784)	----+--------+--------+--------+--------+----* ATTTTAAGATGTGTGGAGTTTTCTTTTCCTTCTCAGAGAAAACACTTGAT

Features of the protein sequence

Description

Length: 3319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06722	100.0	DNAH10 variant ...	Homo sapiens
Q8IVF4	100.0	Dynein heavy ch...	Homo sapiens
EAW98437	100.0	hCG1811879 [Hom...	Homo sapiens
NP_001077369	99.9	dynein, axonema...	Homo sapiens
XP_001915485	93.0	dynein, axonema...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	100	512	PF08393	Dynein heavy chain
	IPR011704	956	1101	PF07728	ATPase associated with various cellular activities
	IPR011704	1298	1445	PF07728	ATPase associated with various cellular activities
	IPR004273	2606	3317	PF03028	Dynein heavy chain
HMMSmart	IPR003593	674	810	SM00382	AAA+ ATPase
	IPR003593	953	1089	SM00382	AAA+ ATPase
	IPR003593	1295	1448	SM00382	AAA+ ATPase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp