ORK07524

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07524

Order Kazusa clone(s) from :

Accession No	AB209568
Product ID	ORK07524
Clone name	fk14877
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZRANB2
cDNA sequence	DNA sequence (3830 bp) Predicted protein sequence (316 aa)
Description	Zinc finger Ran-binding domain-containing protein 2 (Zinc finger protein 265) (Zinc finger, splicing).

Features of the cloned cDNA sequence

Description

Length: 3830 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2878 bp
Genome contig ID	gi89161185r_71201613
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATACTGTAGACAAATGTAAATAAAGCCTGTGAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCATCAAGTGGTGTTTGTTAGAAATAAACTAGAGATTTTTAAACTCTG

Features of the protein sequence

Description

Length: 316 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92805	1.2e-83	100.0	zinc finger pro...	Homo sapiens
XP_001099498	4.9e-83	100.0	zinc finger pro...	Macaca mulatta
O95218	9.5e-82	100.0	Zinc finger Ran...	Homo sapiens
XP_547334	9.5e-82	100.0	similar to Zinc...	Canis lupus fam...
XP_001499224	1.4e-81	99.6	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001876	11	42	PF00641	Zinc finger
HMMPfam	IPR001876	67	96	PF00641	Zinc finger
HMMSmart	IPR001876	13	39	SM00547	Zinc finger
HMMSmart	IPR001876	69	93	SM00547	Zinc finger
ProfileScan	IPR001876	11	42	PS50199	Zinc finger
ProfileScan	IPR001876	67	96	PS50199	Zinc finger
ScanRegExp	IPR001876	15	36	PS01358	Zinc finger
ScanRegExp	IPR001876	71	90	PS01358	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp