ORK06507

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06507

Order Kazusa clone(s) from :

Accession No	AB208798
Product ID	ORK06507
Clone name	ha02747
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	PSD4
cDNA sequence	DNA sequence (5543 bp) Predicted protein sequence (713 aa)
Description	PH and SEC7 domain-containing protein 4 (Pleckstrin homology and SEC7 domain-containing protein 4) (Exchange factor for ADP-ribosylation factor guanine nucleotide factor 6B) (Telomeric of interleukin-1 cluster protein).

Features of the cloned cDNA sequence

Description

Length: 5543 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1753 bp
Genome contig ID	gi89161199f_113548028
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GGATTCACAAATGAATTAAACATGTCCCTGACTCC
Flanking genome sequence (129247 - 129296)	----+--------+--------+--------+--------+----* ATGAGTTGACAATCTTGCCCACTGGTTTCCTGCTCTCAGTTTACAGAGGC

Features of the protein sequence

Description

Length: 713 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92035	100.0	Pleckstrin and ...	Homo sapiens
Q8NDX1	91.4	PH and SEC7 dom...	Homo sapiens
CAD30842	91.4	ADP-ribosylatio...	Homo sapiens
AAH73151	91.4	Pleckstrin and ...	Homo sapiens
AAD00107	91.2	Tic [Homo sapiens].	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001605	437	456	PR00683	Spectrin/pleckstrin-like
	IPR001605	504	521	PR00683	Spectrin/pleckstrin-like
	IPR001605	524	542	PR00683	Spectrin/pleckstrin-like
HMMPfam	IPR000904	188	396	PF01369	SEC7-like
HMMPfam	IPR001849	435	549	PF00169	Pleckstrin-like
HMMSmart	IPR000904	213	396	SM00222	SEC7-like
HMMSmart	IPR001849	435	551	SM00233	Pleckstrin-like
ProfileScan	IPR000904	222	394	PS50190	SEC7-like
ProfileScan	IPR001849	434	549	PS50003	Pleckstrin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp