ORK00997

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00997

Order Kazusa clone(s) from :

Accession No	AB210022
Product ID	ORK00997
Clone name	ha02793
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARID1A
cDNA sequence	DNA sequence (5177 bp) Predicted protein sequence (1374 aa)
Description	AT-rich interactive domain-containing protein 1A (ARID domain- containing protein 1A) (SWI/SNF-related, matrix-associated, actin- dependent regulator of chromatin subfamily F member 1) (SWI-SNF complex protein p270) (B120) (SWI-like protein) (Osa homolog

Features of the cloned cDNA sequence

Description

Length: 5177 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1052 bp
Genome contig ID	gi89161185f_26796520
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTCCACGTGTTAAGAATAAATGTACATTAAATCTT
Flanking genome sequence (184659 - 184708)	----+--------+--------+--------+--------+----* GGTAAGACTTTTGTGAAGCTTTTTATTGTTTTCAAACTAAAACTTGACCT

Features of the protein sequence

Description

Length: 1374 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06104	100.0	ARID1A variant ...	Homo sapiens
BAG10234	100.0	AT-rich interac...	synthetic construct
EAX07794	99.8	AT rich interac...	Homo sapiens
AAN03446	99.8	SWI/SNF chromat...	Homo sapiens
O14497	99.8	AT-rich interac...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001606	668	773	PF01388	AT-rich interaction region
HMMSmart	IPR001606	672	763	SM00501	AT-rich interaction region
ProfileScan	IPR001606	671	762	PS51011	AT-rich interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp