ORK04847

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04847

Order Kazusa clone(s) from :

Accession No	AB209014
Product ID	ORK04847
Clone name	hg03819
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DYNC1I2
cDNA sequence	DNA sequence (2590 bp) Predicted protein sequence (575 aa)
Description	Cytoplasmic dynein 1 intermediate chain 2 (Dynein intermediate chain 2, cytosolic) (DH IC-2) (Cytoplasmic dynein intermediate chain 2).

Features of the cloned cDNA sequence

Description

Length: 2590 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	520 bp
Genome contig ID	gi89161199f_172171646
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGTAGTTACCTATAAATAAAAACAAATATGCGTT
Flanking genome sequence (141521 - 141570)	----+--------+--------+--------+--------+----* AACTTTTCAAATTTTCATTTTTACTCCTTACAACTTGAATTTTTCCATCT

Features of the protein sequence

Description

Length: 575 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92251	100.0	dynein, cytopla...	Homo sapiens
XP_001144171	100.0	hypothetical pr...	Pan troglodytes
XP_860081	99.4	similar to Dyne...	Canis lupus fam...
XP_001367904	97.9	hypothetical pr...	Monodelphis dom...
AAY24133	99.8	unknown [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	316	348	PF00400	WD40 repeat
	IPR001680	403	447	PF00400	WD40 repeat
	IPR001680	451	490	PF00400	WD40 repeat
HMMSmart	IPR001680	259	298	SM00320	WD40 repeat
	IPR001680	305	348	SM00320	WD40 repeat
	IPR001680	402	447	SM00320	WD40 repeat
	IPR001680	450	490	SM00320	WD40 repeat
	IPR001680	495	535	SM00320	WD40 repeat
ProfileScan	IPR001680	247	544	PS50294	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp