ORK07640

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07640

Order Kazusa clone(s) from :

Accession No	AB290158
Product ID	ORK07640
Clone name	hh00016y3
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-5243) was subcloned upstream of the cDNA (5244-11337). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCTGCAGGCG GCCGCGAATT CACTAGTGAT T-5' end of cDNA.
Symbol	DNAH9
cDNA sequence	DNA sequence (11337 bp) Predicted protein sequence (3705 aa)
Description	Homo sapiens mRNA for DNAH9/KIAA0357 variant protein

Features of the cloned cDNA sequence

Description

Length: 11337 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	219 bp
Genome contig ID	gi51511734f_11395129
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGGCCCAGGTTTCTTAATAAAATGATTTACTCTTC
Flanking genome sequence (418661 - 418710)	----+--------+--------+--------+--------+----* AACTGTGTCTGGCCCAGGATTTGAGAGCTGCTGAATCATAAATGATCATG

Features of the protein sequence

Description

Length: 3705 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06712	100.0	DNAH9 variant p...	Homo sapiens
EAW89980	99.9	dynein, axonema...	Homo sapiens
EAW89983	97.9	dynein, axonema...	Homo sapiens
CAB94756	97.9	axonemal dynein...	Homo sapiens
NP_001363	97.9	dynein heavy ch...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	1	86	PF08385	Dynein heavy chain
	IPR013602	585	998	PF08393	Dynein heavy chain
	IPR011704	1441	1585	PF07728	ATPase associated with various cellular activities
	IPR004273	3077	3704	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1160	1296	SM00382	AAA+ ATPase
	IPR003593	1438	1570	SM00382	AAA+ ATPase
	IPR003593	1765	1916	SM00382	AAA+ ATPase
	IPR003593	2112	2215	SM00382	AAA+ ATPase
ScanRegExp	IPR005479	3312	3319	PS00867	Carbamoyl-phosphate synthase L chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2668	ERTLCGDILLITAFISYLGFFT	2689	PRIMARY	22