ORK04566

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04566

Order Kazusa clone(s) from :

Accession No	AB209028
Product ID	ORK04566
Clone name	hh00615
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CHUK
cDNA sequence	DNA sequence (5829 bp) Predicted protein sequence (726 aa)
Description	Inhibitor of nuclear factor kappa-B kinase subunit alpha (EC 2.7.11.10) (I kappa-B kinase alpha) (IkBKA) (IKK-alpha) (IKK-A) (IkappaB kinase) (I-kappa-B kinase 1) (IKK1) (Conserved helix-loop- helix ubiquitous kinase) (Nuclear factor NF-kappa-B inhibitor

Features of the cloned cDNA sequence

Description

Length: 5829 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3637 bp
Genome contig ID	gi89161187r_101838115
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GTTTTTCACTTTGTGTATTAAATGGTTTTTAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTCTTGATCTCTATTCATTATAAAAATCAGATTATAATAAAACAGTT

Features of the protein sequence

Description

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92265	100.0	conserved helix...	Homo sapiens
CAH72401	100.0	conserved helix...	Homo sapiens
O15111	99.8	Inhibitor of nu...	Homo sapiens
XP_001167720	99.7	conserved helix...	Pan troglodytes
XP_507979	99.7	conserved helix...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	25	228	PD000001	Protein kinase
HMMPfam	IPR000719	22	247	PF00069	Protein kinase
HMMSmart	IPR001245	22	308	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	22	308	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	22	309	PS50011	Protein kinase
ScanRegExp	IPR000719	28	51	PS00107	Protein kinase
ScanRegExp	IPR008271	147	159	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp