ORK06533

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06533

Order Kazusa clone(s) from :

Accession No	AB208869
Product ID	ORK06533
Clone name	hh01495
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTPRD
cDNA sequence	DNA sequence (5391 bp) Predicted protein sequence (1478 aa)
Description	Receptor-type tyrosine-protein phosphatase delta precursor (EC 3.1.3.48) (Protein-tyrosine phosphatase delta) (R-PTP-delta).

Features of the cloned cDNA sequence

Description

Length: 5391 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	953 bp
Genome contig ID	gi89161216r_8206988
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGTCTATGTATATATAGACAGTGTGTCCACAAGC
Flanking genome sequence (99935 - 99886)	----+--------+--------+--------+--------+----* AAAAAATAGATACAGTTATCAGTCAGTCAGTTCTTCCATGATTTAGTTTT

Features of the protein sequence

Description

Length: 1478 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92106	100.0	protein tyrosin...	Homo sapiens
NP_001035802	100.0	protein tyrosin...	Homo sapiens
AAI06716	99.7	PTPRD protein [...	Homo sapiens
XP_001112040	99.6	protein tyrosin...	Macaca mulatta
AAI06715	99.7	PTPRD protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	975	982	PR00700	Protein-tyrosine phosphatase
	IPR000242	991	1011	PR00700	Protein-tyrosine phosphatase
	IPR000242	1075	1092	PR00700	Protein-tyrosine phosphatase
	IPR000242	1114	1132	PR00700	Protein-tyrosine phosphatase
	IPR000242	1145	1160	PR00700	Protein-tyrosine phosphatase
	IPR000242	1161	1171	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR013098	1	91	PF07679	Immunoglobulin I-set
	IPR013098	102	198	PF07679	Immunoglobulin I-set
	IPR013151	223	277	PF00047	Immunoglobulin
	IPR003961	296	378	PF00041	Fibronectin
	IPR003961	390	477	PF00041	Fibronectin
	IPR003961	489	570	PF00041	Fibronectin
	IPR000242	946	1177	PF00102	Protein-tyrosine phosphatase
	IPR000242	1235	1468	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR003599	6	92	SM00409	Immunoglobulin subtype
	IPR003598	12	81	SM00408	Immunoglobulin subtype 2
	IPR003599	108	199	SM00409	Immunoglobulin subtype
	IPR003598	114	187	SM00408	Immunoglobulin subtype 2
	IPR003599	215	293	SM00409	Immunoglobulin subtype
	IPR003598	221	282	SM00408	Immunoglobulin subtype 2
	IPR003961	296	375	SM00060	Fibronectin
	IPR003961	391	474	SM00060	Fibronectin
	IPR003599	482	576	SM00409	Immunoglobulin subtype
	IPR003961	489	567	SM00060	Fibronectin
	IPR003961	580	657	SM00060	Fibronectin
	IPR000242	922	1180	SM00194	Protein-tyrosine phosphatase
	IPR003595	1076	1177	SM00404	Protein-tyrosine phosphatase
	IPR000242	1209	1471	SM00194	Protein-tyrosine phosphatase
	IPR003595	1365	1468	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR007110	1	90	PS50835	Immunoglobulin-like
	IPR007110	102	197	PS50835	Immunoglobulin-like
	IPR007110	209	291	PS50835	Immunoglobulin-like
	IPR003961	296	384	PS50853	Fibronectin
	IPR003961	390	484	PS50853	Fibronectin
	IPR003961	489	577	PS50853	Fibronectin
	IPR003961	583	665	PS50853	Fibronectin
	IPR000242	923	1178	PS50055	Protein-tyrosine phosphatase
	IPR000387	1098	1169	PS50056	Protein-tyrosine phosphatase
	IPR000242	1210	1469	PS50055	Protein-tyrosine phosphatase
	IPR000387	1387	1460	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	1117	1129	PS00383	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	1408	1420	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	830	IWVVGPVLAVVFIICIVIAILL	851	PRIMARY	22