ORK04580

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04580

Order Kazusa clone(s) from :

Accession No	AB209042
Product ID	ORK04580
Clone name	hh02276
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CLIP4
cDNA sequence	DNA sequence (5952 bp) Predicted protein sequence (496 aa)
Description	CAP-Gly domain-containing linker protein 4 (Restin-like protein 2).

Features of the cloned cDNA sequence

Description

Length: 5952 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2598 bp
Genome contig ID	gi89161199f_29092887
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GAGCATCAATAAAAAGGGAAGCTGTGTGGTTTTGG
Flanking genome sequence (167291 - 167340)	----+--------+--------+--------+--------+----* AATGGTATCTTGTCATTTACCCTATTTGCAACTCTGCTTTTCTCAGTAAC

Features of the protein sequence

Description

Length: 496 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92279	1.3e-203	100.0	hypothetical pr...	Homo sapiens
EAX00512	2.4e-203	100.0	restin-like 2, ...	Homo sapiens
EAX00510	2.6e-191	99.7	restin-like 2, ...	Homo sapiens
AAP97312	2.6e-191	99.7	unknown [Homo s...	Homo sapiens
Q8N3C7	3e-191	99.7	CAP-Gly domain-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002110	107	148	PF00023	Ankyrin
	IPR002110	150	184	PF00023	Ankyrin
	IPR002110	190	219	PF00023	Ankyrin
	IPR000938	286	351	PF01302	CAP-Gly
HMMSmart	IPR002110	107	145	SM00248	Ankyrin
	IPR002110	150	181	SM00248	Ankyrin
	IPR002110	187	216	SM00248	Ankyrin
ProfileScan	IPR002110	93	224	PS50297	Ankyrin
	IPR002110	187	219	PS50088	Ankyrin
	IPR000938	304	346	PS50245	CAP-Gly

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	469	IYGFFNQAFLVFFILVCLFEFLS	491	PRIMARY	23