ORK06348

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06348

Order Kazusa clone(s) from :

Accession No	AB209055
Product ID	ORK06348
Clone name	hj01978
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PHKG2
cDNA sequence	DNA sequence (4885 bp) Predicted protein sequence (272 aa)
Description	Phosphorylase b kinase gamma catalytic chain, testis/liver isoform (EC 2.7.11.19) (PHK-gamma-T) (Phosphorylase kinase subunit gamma 2) (PSK-C3).

Features of the cloned cDNA sequence

Description

Length: 4885 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4065 bp
Genome contig ID	gi51511732f_30572225
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GACTGTTGGGGAGACAATAAAGAACGCAAATATTC
Flanking genome sequence (107768 - 107817)	----+--------+--------+--------+--------+----* AGTGTAATTTTTGTCTCTTCACACTCACCACATGCAGATCCGGGGTCGGG

Features of the protein sequence

Description

Length: 272 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92292	6.9e-112	100.0	phosphorylase k...	Homo sapiens
EAW52211	6.9e-112	100.0	phosphorylase k...	Homo sapiens
EAW52208	7.4e-112	100.0	phosphorylase k...	Homo sapiens
P15735	9.3e-112	100.0	Phosphorylase b...	Homo sapiens
AAQ02490	9.3e-112	100.0	phosphorylase k...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1	157	PD000001	Protein kinase
FPrintScan	IPR002291	149	160	PR01049	Phosphorylase kinase
	IPR002291	166	181	PR01049	Phosphorylase kinase
	IPR002291	182	200	PR01049	Phosphorylase kinase
	IPR002291	201	215	PR01049	Phosphorylase kinase
	IPR002291	216	231	PR01049	Phosphorylase kinase
	IPR002291	232	245	PR01049	Phosphorylase kinase
HMMPfam	IPR000719	1	157	PF00069	Protein kinase
HMMSmart	IPR002290	1	157	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	157	PS50011	Protein kinase
ScanRegExp	IPR008271	15	27	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp