ORK10429

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10429

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10429
Clone name	hj03737
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj03737 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC GGACGCGTGG G) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	LRPPRC
cDNA sequence	DNA sequence (5040 bp) Predicted protein sequence (1396 aa)
Description	Leucine-rich PPR motif-containing protein, mitochondrial Precursor (130 kDa leucine-rich protein)(LRP 130)(GP130)

Features of the cloned cDNA sequence

Description

Length: 5040 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	849 bp
Genome contig ID	gi89161199r_43868394
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTGTATTTAATTGTTTGAAATAAAAGTGATCCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATTGAATCTCATGCCTGTTAATATCTACACTGTAAGTAGTGACTTCAA

Features of the protein sequence

Description

Length: 1396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P42704	100.0	Leucine-rich PP...	Homo sapiens
BAF82705	99.9	unnamed protein...	Homo sapiens
BAC86287	99.7	unnamed protein...	Homo sapiens
XP_001143797	99.4	leucine-rich PP...	Pan troglodytes
XP_515440	99.4	leucine-rich PP...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002885	165	199	PF01535	Pentatricopeptide repeat
	IPR002885	200	234	PF01535	Pentatricopeptide repeat
	IPR002885	235	269	PF01535	Pentatricopeptide repeat
	IPR002885	270	304	PF01535	Pentatricopeptide repeat
	IPR002885	442	476	PF01535	Pentatricopeptide repeat
	IPR002885	714	748	PF01535	Pentatricopeptide repeat
	IPR002885	751	785	PF01535	Pentatricopeptide repeat
	IPR002885	958	992	PF01535	Pentatricopeptide repeat
	IPR002885	1321	1355	PF01535	Pentatricopeptide repeat
HMMTigr	IPR002885	165	199	TIGR00756	Pentatricopeptide repeat
	IPR002885	200	234	TIGR00756	Pentatricopeptide repeat
	IPR002885	235	269	TIGR00756	Pentatricopeptide repeat
	IPR002885	270	304	TIGR00756	Pentatricopeptide repeat
	IPR002885	751	785	TIGR00756	Pentatricopeptide repeat
	IPR002885	958	992	TIGR00756	Pentatricopeptide repeat
	IPR002885	1321	1355	TIGR00756	Pentatricopeptide repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp