ORK07661

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07661

Order Kazusa clone(s) from :

Accession No	AB208873
Product ID	ORK07661
Clone name	hj04451
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARHGAP29
cDNA sequence	DNA sequence (5031 bp) Predicted protein sequence (1252 aa)
Description	PTPL1-associated RhoGAP 1

Features of the cloned cDNA sequence

Description

Length: 5031 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1270 bp
Genome contig ID	gi89161185r_94310777
PolyA signal sequence (None)	+--------+--------+----*----+---- AATATATATATATATATATATCAACTTGTTAAATT
Flanking genome sequence (99966 - 99917)	----+--------+--------+--------+--------+----* ATTTCATGTTCCCGTGGCTTCTTTTCAGTTGTTGCCTATTACAGTATGAG

Features of the protein sequence

Description

Length: 1252 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92110	100.0	PTPL1-associate...	Homo sapiens
AAH93767	99.9	Rho GTPase acti...	Homo sapiens
Q52LW3	99.8	Rho GTPase-acti...	Homo sapiens
XP_001156168	99.2	PTPL1-associate...	Pan troglodytes
AAB81012	99.0	PTPL1-associate...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	604	651	PF00130	Protein kinase C
HMMPfam	IPR000198	676	851	PF00620	RhoGAP
HMMSmart	IPR002219	602	648	SM00109	Protein kinase C
HMMSmart	IPR000198	673	874	SM00324	RhoGAP
ProfileScan	IPR002219	603	648	PS50081	Protein kinase C
ProfileScan	IPR000198	662	877	PS50238	RhoGAP
ScanRegExp	IPR002219	604	648	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp