ORK05502

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05502

Order Kazusa clone(s) from :

Accession No	AB209090
Product ID	ORK05502
Clone name	hj05243
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IKBKB
cDNA sequence	DNA sequence (5002 bp) Predicted protein sequence (483 aa)
Description	Inhibitor of nuclear factor kappa-B kinase subunit beta (EC 2.7.11.10) (I-kappa-B-kinase beta) (IkBKB) (IKK-beta) (IKK-B) (I-kappa-B kinase 2) (IKK2) (Nuclear factor NF-kappa-B inhibitor kinase beta) (NFKBIKB).

Features of the cloned cDNA sequence

Description

Length: 5002 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3399 bp
Genome contig ID	gi51511724f_42148756
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CTAGCATTTAATAAAGCACAATTTTGGAAACCCTG
Flanking genome sequence (160376 - 160425)	----+--------+--------+--------+--------+----* GTAAATGACAGTGGGAAATAACACCCGAAAGGCAAGGACGGGCAGATTGG

Features of the protein sequence

Description

Length: 483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92327	1.5e-194	100.0	inhibitor of ka...	Homo sapiens
BAG64369	6.6e-180	99.7	unnamed protein...	Homo sapiens
BAG64556	1.3e-179	99.7	unnamed protein...	Homo sapiens
EAW63223	3.6e-177	99.7	inhibitor of ka...	Homo sapiens
BAF83641	3.6e-177	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	18	173	PD000001	Protein kinase
HMMPfam	IPR000719	18	173	PF00069	Protein kinase
HMMPfam	IPR000626	267	305	PF00240	Ubiquitin
HMMSmart	IPR002290	1	263	SM00220	Serine/threonine protein kinase
HMMSmart	IPR001245	9	258	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	1	251	PS50011	Protein kinase
ProfileScan	IPR000626	258	335	PS50053	Ubiquitin
ScanRegExp	IPR008271	92	104	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp