ORK07433

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07433

Order Kazusa clone(s) from :

Accession No	AK226118
Product ID	ORK07433
Clone name	hj06248
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZMYM2
cDNA sequence	DNA sequence (4983 bp) Predicted protein sequence (822 aa)
Description	MYM-type zinc finger protein 2 (Zinc finger protein 198) (Fused in myeloproliferative disorders protein) (Rearranged in atypical myeloproliferative disorder protein).

Features of the cloned cDNA sequence

Description

Length: 4983 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	676 bp
Genome contig ID	gi51511729f_19330885
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTTTTGTTCCCCTTATTAAAACCTTAGTGTCCTT
Flanking genome sequence (227947 - 227996)	----+--------+--------+--------+--------+----* TTCTCATTTGTGGCTTTCTGCATCACCCAATCAATAAAAAACAAATATAT

Features of the protein sequence

Description

Length: 822 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAC23591	97.9	zinc finger pro...	Homo sapiens
CAH56193	97.9	hypothetical pr...	Homo sapiens
Q9UBW7	97.9	Zinc finger MYM...	Homo sapiens
CAL38487	97.7	hypothetical pr...	synthetic construct
CAA73875	97.7	FIM protein [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010507	105	139	PF06467	Zinc finger
	IPR010507	146	185	PF06467	Zinc finger
	IPR010507	192	226	PF06467	Zinc finger
HMMSmart	IPR011017	30	65	SM00746	TRASH
	IPR011017	84	120	SM00746	TRASH
	IPR011017	126	161	SM00746	TRASH
	IPR011017	172	207	SM00746	TRASH
	IPR011017	213	248	SM00746	TRASH

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp