ORK01841

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01841

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01841
Clone name	hk01137
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPHB3
cDNA sequence	DNA sequence (4236 bp) Predicted protein sequence (1142 aa)
HaloTag ORF Clone	FHC01841
Flexi ORF Clone	FXC01841
Description	Ephrin type-B receptor 3 precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor HEK-2) (Tyrosine-protein kinase TYRO6).

Features of the cloned cDNA sequence

Description

Length: 4236 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	773 bp
Genome contig ID	gi89161205f_185662252
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGCTGGGCCGACAGCAGAATAAAGGCAATAAGATG
Flanking genome sequence (120639 - 120688)	----+--------+--------+--------+--------+----* ATTCTCTTGCCCCTTCTTATTCCTCCTCCCAAAGCAAGATTCCCTGATTC

Features of the protein sequence

Description

Length: 1142 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516918	94.8	ephrin receptor...	Pan troglodytes
P54753	100.0	Ephrin type-B r...	Homo sapiens
CAA53021	99.5	protein tyrosin...	Homo sapiens
XP_613645	98.2	similar to ephr...	Bos taurus
XP_001097522	97.6	similar to ephr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	193	356	PD001495	Ephrin receptor
BlastProDom	IPR000719	784	1042	PD000001	Protein kinase
FPrintScan	IPR003962	611	620	PR00014	Fibronectin
	IPR003962	624	634	PR00014	Fibronectin
	IPR003962	645	663	PR00014	Fibronectin
	IPR003962	663	677	PR00014	Fibronectin
	IPR001245	855	868	PR00109	Tyrosine protein kinase
	IPR001245	892	910	PR00109	Tyrosine protein kinase
	IPR001245	944	954	PR00109	Tyrosine protein kinase
	IPR001245	963	985	PR00109	Tyrosine protein kinase
	IPR001245	1007	1029	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	183	356	PF01404	Ephrin receptor
	IPR003961	484	579	PF00041	Fibronectin
	IPR003961	597	679	PF00041	Fibronectin
	IPR001245	777	1036	PF07714	Tyrosine protein kinase
	IPR001660	1067	1131	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001090	183	356	SM00615	Ephrin receptor
	IPR003961	484	579	SM00060	Fibronectin
	IPR003961	597	676	SM00060	Fibronectin
	IPR002290	777	1040	SM00220	Serine/threonine protein kinase
	IPR001245	777	1036	SM00219	Tyrosine protein kinase
	IPR001660	1066	1133	SM00454	Sterile alpha motif SAM
ProfileScan	IPR003961	484	587	PS50853	Fibronectin
	IPR003961	597	688	PS50853	Fibronectin
	IPR000719	777	1040	PS50011	Protein kinase
	IPR001660	1069	1133	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	337	357	PS00790	Receptor tyrosine kinase
	IPR001426	400	420	PS00791	Receptor tyrosine kinase
	IPR000719	783	809	PS00107	Protein kinase
	IPR008266	898	910	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	702	PLIVGSATAGLVFVVAVVVIAIV	724	PRIMARY	23