ORK04484

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04484

Order Kazusa clone(s) from :

Accession No	AB208829
Product ID	ORK04484
Clone name	hk01154
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CCNF
cDNA sequence	DNA sequence (4087 bp) Predicted protein sequence (701 aa)
Description	G2/mitotic-specific cyclin-F.

Features of the cloned cDNA sequence

Description

Length: 4087 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1831 bp
Genome contig ID	gi51511732f_2321131
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GGGTGTTGTGAGGATTAAATGTGAGGAGGATAGTG
Flanking genome sequence (127724 - 127773)	----+--------+--------+--------+--------+----* GCAGATGAGTGATGGACGTCCTTCACTGCCTCGGCCCCTTGTCCAGGGGC

Features of the protein sequence

Description

Length: 701 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92066	100.0	G2/mitotic-spec...	Homo sapiens
P41002	98.7	G2/mitotic-spec...	Homo sapiens
AAX29848	98.7	cyclin F [synth...	synthetic construct
XP_510746	98.5	cyclin F [Pan t...	Pan troglodytes
BAG36170	98.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006671	196	321	PF00134	Cyclin
HMMPfam	IPR004367	323	450	PF02984	Cyclin
HMMSmart	IPR006670	230	314	SM00385	Cyclin
HMMSmart	IPR006670	331	409	SM00385	Cyclin
ScanRegExp	IPR006671	225	256	PS00292	Cyclin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp