ORK06002

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06002

Order Kazusa clone(s) from :

Accession No	AB209074
Product ID	ORK06002
Clone name	hk01724
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MKNK2
cDNA sequence	DNA sequence (4093 bp) Predicted protein sequence (208 aa)
Description	MAP kinase-interacting serine/threonine-protein kinase 2 (EC 2.7.11.1) (MAP kinase signal-integrating kinase 2) (Mnk2).

Features of the cloned cDNA sequence

Description

Length: 4093 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3465 bp
Genome contig ID	gi42406306r_1888472
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTTTTGTAAAGATTTAATAAAAGTCAAAAAACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCTGTGTGCCTGAGTTTTAGTTTTCTGTCACCGCATAAGGAGCCATCCAC

Features of the protein sequence

Description

Length: 208 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92311	3.9e-85	100.0	MAP kinase-inte...	Homo sapiens
2AC3	4.8e-69	97.1	MAP kinase-inte...	Homo sapiens
CAB70816	4.8e-69	97.1	hypothetical pr...	Homo sapiens
BAG57165	5e-69	97.1	unnamed protein...	Homo sapiens
BAG64449	5.7e-69	97.1	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	5	172	PD000001	Protein kinase
HMMPfam	IPR000719	5	173	PF00069	Protein kinase
HMMSmart	IPR002290	4	173	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	173	PS50011	Protein kinase
ScanRegExp	IPR008271	6	18	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	82	DLWSLGVILYILLSGYPPFVGRC	104	PRIMARY	23