ORK06548

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06548

Order Kazusa clone(s) from :

Accession No	AB209080
Product ID	ORK06548
Clone name	hk04088
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PYGB
cDNA sequence	DNA sequence (4093 bp) Predicted protein sequence (865 aa)
Description	Glycogen phosphorylase, brain form (EC 2.4.1.1).

Features of the cloned cDNA sequence

Description

Length: 4093 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1494 bp
Genome contig ID	gi51511747f_25076748
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- AAAACTGATTAAACCTTTGTGGCTGTGGTTGGCTG
Flanking genome sequence (149901 - 149950)	----+--------+--------+--------+--------+----* ACATGGGGTCTGTGTTTCACTAACTAACTAACTAACTGCAGGTGGTGGTA

Features of the protein sequence

Description

Length: 865 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92317	100.0	brain glycogen ...	Homo sapiens
XP_525293	99.7	brain glycogen ...	Pan troglodytes
P11216	99.7	Glycogen phosph...	Homo sapiens
AAB60395	99.5	glycogen phosph...	Homo sapiens
ABW03734	99.6	phosphorylase, ...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000811	134	852	PF00343	Glycosyl transferase
HMMTigr	IPR011833	46	850	TIGR02093	Glycogen/starch/alpha-glucan phosphorylase
ScanRegExp	IPR000811	695	707	PS00102	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	IPAFACAAAFLLHLFSSASAGAM	23	PRIMARY	23